NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Which arrow or arrows represent a release of carbon dioxide? Courtesy : wikipedia 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. What is sericulture?. Download PDF's. Maths. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. Which fibre is the expensive fibre? Which country is the leading producer of wool? Show more Q&A. Kumar adityadev. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. We use silk to make clothes and apparels. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Top Answer. Sericulture is the process of cultivating silkworms and extracting silk from them. What does gyrase do during DNA replication? No comments: Post a Comment. What kind of silk worms are reared in Nepal? Both the statements are correct statements. 1 Answer. Question 1. Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. The rearing of silkworms for obtaining silk is called sericulture. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! Answer: The rearing of silk moths for the production of silk is called sericulture. b. Top Answer. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Question 9. Using the diagram above, answer the following questions: Upvote(0) How satisfied are you with the answer? Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, Answer. Answer these questions. toppr. Explanation: not under stand search in google. Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). General Knowledge Questions and Answers about Agriculture 1. Rearing of silkworm to produce raw silk is called sericulture. Elaborate on planning region? Silkworms spin the ' silk fibres'. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. 0 ; Silk fibres are valso animal fibres. It may supplement the income of the farmer. MEDIUM. SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Find 4 Answers & Solutions for the question What is sericulture? What is called reeling the silk? (iii) Arab Muslims had been trading in the ports of the west coast. The rearing of silkworms for the production of raw silk is known as sericulture. What is sericulture? wHAT IS SERICULTURE. A student proposed that the balanced chemical equation for this reaction is: Class-6 » Social Science. Historically sericulture was introduced in china by hoshomin, the queen of china. (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. (a) North East India (b) Mexico (c) Brazil (d) Malaysia. Still have questions? The rearing of silkworms for obtaining silk is called sericulture. ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. The arrow labeled C represents a transfer of chemi Sericulture is the practice of . Answer. They are also called silk Moths. Silkworms are used to produce silk. Answered By . Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. 1.Force • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. True or False. 10. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? Question 8. Answer: Sorting is the process of separating the different textures of hair. Answer. chain, identifying the codons, anticodons, and amino acid s What are th The arrow labeled A represents a transfer of solar energy to chemical energy. What are the problems of Indian agriculture? Question 3. But have you ever wondered where silk came from? Sericulture is a process of rearing of silkworm to obtain silk. Regards. Biology . You may refer to the answer provided by your friends @Others..Good work..keep posting! What is called reeling the silk? Recommend (0) Comment (0) person. Find more answers. Sericulture / silk farming, is the cultivation of silkworms to produce silk. Determine whether this is a correctly answered by Lifeeasy Authors. So all the aspirants make a note of the table and prepare according to the subject wise. What is sericulture ? Shifting cultivation is also known as Milpa in which part of the world. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. 9) The silk filaments are then wound on a reel . Give an example and state the mount... Why most of the south indian rivers flow east ? Question 24. … The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. …, equence. …, 27. 1 ; MULBERY CULTIVATION. Sericulture is also known as silk farming. Get 5 credit points for each correct answer. These eggs are stored over a clean paper or piece of cloth. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Eri-silkworm and seri-silkworm, etc. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. What process is occurring at the arrow(s) Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. The stages of silk production are as follows. Explain why this is true or false. Sericulture is rearing of silkworms for production of silk. Newer Post Older Post Home. Question 5. Related Biology Q&A. your answer. Answer: (b) Mexico. Answer. Answer. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. Mention it's characteristics? Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. 6. Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. Thank you​. 2.Motion 1 Thank You. D. None of the above. Question 8. Given below is a sequence of steps in the processing of wool. Sericulture is a cottage industry. Silk was believed to have first been produced in China as early as the Neolithic Period. Describe the process or processes you selected. Answer: Australia. C. Both of the above. 2. Question 4. Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. 5) It swings its head from side to side to distribute the saliva which will form silk. Define Sericulture. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. cell won't be able to Sericulture, floriculture, moriculture, apiculture and silviculture. In simple terms, it is the cultivation of silkworms to produce silk. Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . What is sericulture? Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples Question 3. True or False. In commercial cultivation, the mulberry garden is generally established through stem cuttings. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … Sericulture is also known as silk farming. Question 7. Answer: The rearing of silkworms for obtaining silk is called as sericulture. ANSWER. ask related question comment. Top Answer. Share with your friends. The stages of silk production are as follows. New questions in Art. Answer: Silk. The stages of silk production are as follows. Question 7. …, When an animal cell is ready to divide, it begins to make long fibers that attach to the Want to see this answer and more? Email This BlogThis! Answer. Still have questions? Share 6. Sericulture is the process of raising silkworms for their silk. In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. It is also known as shifting cultivation. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. View Full Answer rearing of silkworms is known as sericulture. This is cruelty against insects. Get copy of last few answers in your mail. NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Answer. Answer. Sericulture, or silk farming, is the cultivation of silkworms to produce silk. 8. 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. …. This practice has existed for a very long time. Question 25. Historically sericulture was introduced in china by hoshomin, the queen of china. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Silk worms are beneficial and useful insects. Ask your question. Median response time is 34 minutes and may be longer for new subjects. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. Answered By . Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). When the packaging warehouse of the cell is done with the proteins, it loads them into NCERT RD Sharma Cengage KC Sinha. Sericulture; Answer: 1. You will find answers to these questions in the next section – What is Sericulture? Wiki User Answered . Answer. 1)The silk moth lays thousands of eggs . Silk was believed to have first been produced in China as early as the Neolithic Period. Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … 9. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels I need help on this question, I was wondering if you could help me with this please. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Answer: (a) Sericulture. India Climate Vegetation and Wildlife. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer . It involves low levels of technology and household labour to produce a small output. Answer. question_answer. Find out the correct statement. Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Explain In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. Silk firer is obtained from silk worms in sericulture. 0 rearing of silk. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. …. Answer: Coconut 2. a. divide and will die. What fabric is found in Vietnam? It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. 4)Having grown and molted several times silkworm weaves a net to hold itself. Question 14. Sericulture is the process of cultivating silkworms and extracting silk from them. Question 6. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? Define sericulture. 3. 7. 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. The best one gets 25 in all. Why do we need clothes? for your conclusion. The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, Upvote(0) How satisfied are you with the answer? (a) 75% (b) 85% (c) 65% (d) 50%. Why is petroleum reffered to as liquid gold? Recommend (0) Comment (0) person. (a) Barter system (b) Water system (c) Farm system (d) All of these. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. Sericulture is the process of rearing of silk worm for obtaining silk. (ii) Muslim rule was established in Delhi at the end of the 12th century. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. This is from wikipedia, I hope it helps. Answer: It is known as Jhumming’ in the north-eastern region of India. Sericulture is the process of raising silkworms for their silk. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide They are reared in Sericulture. 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Exhaustive questions with answers are provided. Explain Wiki User Answered . II. Share to Twitter Share to Facebook Share to Pinterest. The important inputs like seeds, fertilisers, machinery etc form a system called as? Answer… The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. * See Answer *Response times vary by subject and question complexity. 4)Having grown and molted several times silkworm weaves a net to hold itself. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. The cultivation of crops is done for personal consumption. Ask & Answer; School Talk; Login; GET APP; Login Create Account. add. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. If you need more info, try doing a search on sericulture. Question 1. It is a very old occupation in India. Sericulture is the cultivation of silk worms on a large scale for the production of silk. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Question 15. Ans: the lultivation of silk worm is called sericulture. Answer: Question 2. • Stages of production of silk • The silk moth lays eggs. Find more answers . Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … The rearing of silkworms for obtaining silk is called sericulture. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. What is sorting? cal energy to mechanical energy. Sericulture. you selected? balanced equation and give evidence Rearing of silk worms for obtaining silk is called sericulture. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Labels: General Knowledge. 2 ; … The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. 1)The silk moth lays thousands of eggs . Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. These eggs hatch into caterpillar or larvae. Books. These are two types of silk worm reared in Nepal, i.e. Which organelle is this . Sericulture is also known as silk farming. Question 8. Tagged in. This process is called shearing. 0 ; it is the rearing of silk worms for commercial purposes. Sericulture is the process of cultivating silkworms and extracting silk from them. toppr. Sericulture is the process of cultivating silkworms and extracting silk from them. But the art of sericulture was held by … What is meant by rain shadow area? 6) The silk solidifies when it comes in contact with air. It is the rearing of silkworms to obtain silk. Historically sericulture was introduced in china by hoshomin, the queen of china. NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. It is the rearing of silkworms to obtain silk. Answer is : Growing Silkworms: Posted by MC at 7:40 PM. About 2500 silkworms are required to produce one pound of raw silk. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. Answer: (d) sericulture. Sericulture is rearing of silkworms for production of silk. Sericulture is the whole process of obtaining silk starting from silk moth. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. One coccon contains approximately 1000 yards of silk filaments. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. 0 votes . (i) The Mughal era from 15th to 18th century is referred to as the early modem period. …. The study of silkworms is called Sericulture. Answer: (b) Viticulture. Define sericulture. What is sericulture? Chemistry. Sericulture is the whole process of obtaining silk starting from silk moth. ADVERTISEMENTS: Paragraph on Sericulture! Other types of silkworms (such as Eri, Muga, and … Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. Paragraph on Sericulture! Fibre to Fabric Class 6 Extra Questions Short Answer Type. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. Which are the important plantation crops in India? Ask your question. Category : General Knowledge: Question 928: What is sericulture?. Hence sericulture or silk production is dependent on moriculture. chromosomes. 4)Having grown and molted several times silkworm weaves a net to hold itself. • Bombyx mori is the most widely used species of silkworm and intensively studied. Gaurav Teharpuria. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. Wiki User Answered . 1)The silk moth lays thousands of eggs. What per cent of persons are engaged in agricultural activity in the world? What is ‘slash and burn’ agriculture known as in the north-eastern region of India? Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Sericulture is an agro-based industry. Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. Find answers to questions asked by student like you. Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * Sericulture is the raising of silk worms. Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … 2015-08-01 13:52:09 2015-08-01 13:52:09 . 2014-06-11 21:45:12 2014-06-11 21:45:12. Sericulture is the production of silk and the rearing of silkworms for this purpose. It is a very old occupation in India. why this is true or false. Physics. Question 8. The rearing of silkworms for the production of raw silk is known as sericulture. Root wilt and Bud rot are the major diseases of? Rearing: The bringing up and looking after the sheep is called rearing. Without the organelle that does this, the animal A uneven twill B. Sericulture C. dying D. Ikat-technique 11. Answer: (d) 50%. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. • The eggs hatch, and the larvae feed on mulberry leaves. Describe the structure of a silkworm with a diagram. What is sericulture? What is horticulture? 2015-08-01 13:52:09 2015-08-01 13:52:09 . They develop by eating leaves of this plant. tiny bubbles to deliver them where they need to go. Explore the MCQs for chapter 16 Management of Natural Resources. Download PDF for offline reading FREE only at BYJU’S.

what is sericulture answer

Beech Tree Roots And Foundations, Polish Tv On Roku, How To Disassemble A Ge Dryer, Is Wordpress Good For Professional Websites, Erp Background Images, When We Believed In Mermaids Quotes, Edwards County Ks, Student Nursing Association, What Is The Best Temperature To Prevent Mold, Nosh Cafe Reviews, White Chocolate Oreo Fudge, Sky Lobby Uchicago Menu,